DNA Typing - bsapp.com

DNA Typing - bsapp.com

DNA Typing bsapp.com bsapp.com DNA strands come from the

nucleus or the mitochondria bsapp.com DNA Strands Building

block of genetic makeup A complete copy of an individuals entire genome exist in nearly every cell Each persons genome is made up of billions of base pairs Most base pairs are junk DNA bsapp.com

DNA is made up of chromosomes which contain matching genes called alleles bsapp.com

Base pairs exist at the basic level of DNA bsapp.com Base Pairs

Adenine Thymine Guanine Cytosine bsapp.com Variable Number Tandem

Repeaters (VNTR) Portions of DNA sequences are repeated These repetitions vary among individuals CACATCTATCTATCTATCTATCTA TCTATCTATCTATCTATCTATTGC

bsapp.com Forensic DNA Testing Only one-tenth of a percent of DNA differs from one human to the next

This still leaves millions of bases to analyze for differences bsapp.com Types of DNA Testing PCR (Polymorphism Chain Reaction)

RFLP (Restriction Fragment Length Polymorphism) STR (Short Tandem Repeat) mtDNA (Mitochondrial DNA Analysis) bsapp.com

PCR (Polymorphism Chain Reaction) Doesn't accomplish DNA typing Increases the amount of DNA available for typing by producing millions of copies

Use to amplify tiny quantities and degraded samples Extremely sensitive to contamination bsapp.com Basic Procedure for Typing

bsapp.com DNA is cut into different size VNTRs by the use of restriction enzymes bsapp.com

Fragments are placed on a gel plate bsapp.com Fragments are separated by electrophoresis

bsapp.com The DNA is then transferred from the gel plate and made visible bsapp.com

RFLP (Restriction Fragment Length Polymorphism) Oldest/Cheapest test Requires large amounts of nondegraded DNA Utilizes the longer sequences of

VNTRs bsapp.com STR (Short Tandem Repeat) or SSR (Simple Sequence Repeats) Used to evaluate specific regions (loci)

of DNA strands Utilizes shorter stands than VNTRs May by used on much smaller, older, and more degraded samples Usually requires PCR prior to testing bsapp.com mtDNA

(Mitochondrial DNA) Uses DNA from a cellular organelle called a mitochondrion Mitochondrial DNA degrades at a much slower rate than nuclear DNA Allows analysis of older biological

samples, such as hair and bones Not as precise as STR Extremely expensive and time consuming bsapp.com Reading DNA Tests bsapp.com

bsapp.com bsapp.com bsapp.com

Recently Viewed Presentations

  • Rocky Mount High School - Nash-Rocky Mount SD / Homepage

    Rocky Mount High School - Nash-Rocky Mount SD / Homepage

    Extreme Rock, Paper, Scissors ice-breaker. Directions: Pair off into teams of two. Play each other in the normal version of rock, paper, scissors.
  • Course 7: Electronics

    Course 7: Electronics

    ( to be displayed when flashcard moused over) Use . 2,5mm . Norsk (2+E) cable . to supply a isolator that will allow the water heater to be supplied from. Option 2: Use . 2,5mm flat twin and earth (2+E)...
  • Universally Designed Documents

    Universally Designed Documents

    Choosing a Device: Questions to Consider. What do I want out of the device? Just for reading? Multiple uses? (apps, internet, audio books, video) Textbooks vs. mainstream fiction and nonfiction?
  • Bit of Administration .  6-Week Test  TONIGHT! 7:15-8:30,

    Bit of Administration . 6-Week Test TONIGHT! 7:15-8:30,

    Central Force = Gravitational Force Velocity depends only on distance, not on mass of planet Velocity decreases w. greater distance Kepler's 3rd Law A C P Kepler's 3rd Law In general, in units of cm, sec, gms For the Earth...
  • Chapter 11 Section 1 Viruses

    Chapter 11 Section 1 Viruses

    - used to produce medicine (Insulin) FUNGI Eukaryotes Cell walls Heteroptrophs (decomposers) Uni- or multi-cellular Mold, mushrooms, yeast Fungi Cont. Made of HYPHAE - branching, hollow tubes that make up the body of a fungus Fungi Cont. Obtain food by...
  • Laws of Exponents

    Laws of Exponents

    I teach this in High school Algebra but didn't see a high school common core that fit well. The one I use is okay. Best match is 8th Grade common core - Expressions and Equations - Work with radical and...
  • Worm Dissection

    Worm Dissection

    CLITELLUM = ring Doesn't go all the way around Closest to anterior end Makes mucous for reproduction 2 opening digestive system MOUTH ANUS Prostomium covers/protects mouth opening senses light and dark/chemicals (food) EXTERNAL STRUCTURES EXTERNAL STRUCTURES CUTICLE (non-cellular protective layer)...
  • Diagramming Atoms - west-jefferson.k12.oh.us

    Diagramming Atoms - west-jefferson.k12.oh.us

    Diagramming Atoms Labeling Electrons - Part 1 Supplement to Book - Glencoe: Chapter 22 and 19-3 First a bit of Review! Atomic number - number of protons in the nucleus of an atom Mass number - number of protons +...